Overexpression of multiple            genes with and without knockdown resistance mutations confers high resistance to deltamethrin in

Chamnanya Saowanee; Kiddela Benyapa; Saingamsook Jassada; Nachaiwieng Woottichai; Lumjuan Nongkran; Somboon Pradya; Yanola Jintana

doi:10.1186/s40249-024-01269-2

高级检索

IP登录

登录IP

切换

退出

贫困所致传染病（英文）

• Research Article •

Overexpression of multiple cytochrome P450 genes with and without knockdown resistance mutations confers high resistance to deltamethrin in Culex quinquefasciatus

作者及单位信息

出版日期： 2025 -02 -10 ·

DOI： 10.1186/s40249-024-01269-2

APP内阅读

ABSTRACT

BackgroundThe cytochrome P450s-mediated metabolic resistance and the target site insensitivity caused by the knockdown resistance ( kdr) mutation in the voltage-gated sodium channel ( vgsc) gene were the main mechanisms conferring resistance to deltamethrin in Culex quinquefasciatus from Thailand. This study aimed to investigate the expression levels of cytochrome P450 genes and detect mutations of the vgsc gene in deltamethrin-resistant Cx. quinquefasciatus populations in Thailand.

MethodsTwo field-collected strains of Cx. quinquefasciatus, Cq_SP and Cq_NiH, were selected with deltamethrin to generate the resistant strains Cq_SP-R and Cq_NiH-R, respectively. Bioassays were tested on larvae and adults of each strain according to WHO methods. Eight cytochrome P450 genes were analyzed for the expression level using quantitative real time-PCR. The cDNA of mosquitoes was amplified and sequenced for four fragments of vgsc gene. The kdr L1014F mutation and the haplotype of the CYP9M10 gene were detected in survivor and dead mosquitoes after exposure to the deltamethrin WHO test paper. Statistical analyses were performed using Fisher’s exaction test.

ResultsBioassay tests revealed a significantly higher resistance level in Cq_SP-R than in Cq_NiH-R strains in both larvae and adults. All eight cytochrome P450 genes were significantly overexpressed in larvae of Cq_NiH-R strain compared to the parent and susceptible Cq_Sus strains. The CYP6AA7 and CYP9J34 genes had the highest expression ratios, exceeding 24-fold in Cq_NiH-R larvae. In Cq_SP-R strain, the CYP4H34 and CYP9J34 genes were overexpressed in both stages. The kdr L1014F mutation was found in Cq_SP-R and its parent Cq_SP strains with a significantly higher mutant allele frequency in the survivor mosquitoes than in dead mosquitoes ( P < 0.0001). The V240M and novel L925F mutations were found only in Cq_SP-R strain. Heterozygous genotype for the D-Cu(+)/Cu(-) of CYP9M10 gene was detected in Cq_NiH and Cq_NiH-R strains but other strains were mostly homozygous for the Cu(-)/Cu(-).

ConclusionsOverexpression of multiple cytochrome P450 genes alone has a relatively minor impact on resistance. The combined mechanisms of cytochrome P450- and kdr-mediated resistance result in significantly higher resistance to deltamethrin in Cx. quinquefasciatus. This study supports sustainable public health initiatives in Thailand to address the evolving challenges of insecticide resistance.

KEYWORDS： Culex quinquefasciatus ;Insecticide resistance;Pyrethroid;Deltamethrin;Cytochrome P450s;Knockdown resistance ( kdr) ; Voltage-gated sodium channel (vgsc)

NOTES:

Full list of author information is available at the end of the article

NOTES:

Author contributions

SC contributed to methodology, investigation and original draft writing. BK work on methodology and JS conducted investigation. Additionally, WN, NL and PS contributed to the writing-review and editing. J.Y. was involved in conceptualization, methodology, investigation, formal analysis, original draft writing, writing-review and editing, supervision, project administration, and funding acquisition. All the authors have read and approved the final manuscript.

引用本文

Saowanee Chamnanya,Benyapa Kiddela,Jassada Saingamsook,et al. Overexpression of multiple cytochrome P450 genes with and without knockdown resistance mutations confers high resistance to deltamethrin in Culex quinquefasciatus [J]. Infect Dis Poverty,2025,14(01)：38-49.

DOI:10.1186/s40249-024-01269-2

PERMISSIONS

Request permissions for this article from CCC.

评价本文

*以上评分为匿名评价

© The Author(s) 2025. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1 .0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Background

The southern house mosquito, Culex quinquefasciatus, is the primary vector for several pathogens especially including the West Nile virus and the parasitic Wuchereria bancrofti nematode (agent of bancroftian filariasis) [ 1 ]. Bancroftian filariasis is endemic along the Thailand-Myanmar border, with a high incidence among Myanmar migrant workers in Thailand [ 2 , 3 ]. The influx of Myanmar migrant workers in Thailand has raised concerns due to the potential transmission of bancroftian filariasis, aided by the widespread breeding of Cx. quinquefasciatus in urban areas [ 4 ]. In Thailand, the government implements a lymphatic filariasis (LF) surveillance program on a biennial basis, primarily targeting immigrants [ 2 ]. Mosquito control is the primary strategy for mitigating the transmission of mosquito-borne diseases, often involving the use of insecticides to manage vector density in endemic areas or during epidemic outbreaks [ 5 , 6 ]. Pyrethroid insecticides have become increasingly important in mosquito control initiatives globally, including Thailand [ 7 , 8 ]. However, their extensive use has led to the emergence of insecticide resistance in Aedes and Culex mosquitoes, representing a pressing concern [ 9 ]. High level of resistance to pyrethroid insecticides in Cx. quinquefasciatus has been documented across Thailand [ 4 , 10 ].

Major insecticide resistance mechanisms, including metabolic, target site and cuticular resistance, play a role in mosquito resistance to pyrethroid insecticides [ 11 ]. Metabolic resistance is due to the increased activity of metabolic enzymes, such as cytochrome P450 monooxygenases, which can metabolize pyrethroid, leading to lower toxicity and more efficient excretion of the active ingredients, particles pyrethroid [ 11 ]. Many insects rely heavily on the overexpression of cytochrome P450 ( CYP450) genes to detoxify xenobiotics from their bodies [ 12 ]. Cytochrome P450s are a large superfamily where the CYP4, CYP6 and CYP9 families play an important role in the biodegradation of insecticide particles in insecticide resistance in mosquitoes, including Cx. quinquefasciatus [ 13 , 14 , 15 ]. Target-site resistance, known as knockdown resistance ( kdr), is attributed to mutations in the voltage-gated sodium channel ( vgsc) gene within the protein-coding regions [ 16 ]. As this reduces the ability of the pyrethroid to affect its target VGSC protein, target-site resistance often results in high levels of pyrethroid resistance. The common kdr L1014F mutation conferred resistance to pyrethroid in the Cx. quinquefasciatus populations from several countries including Thailand [ 10 , 17 , 18 , 19 ].

In Thailand, there have been frequent reports of Cx. quinquefasciatus developing resistance to pyrethroid [ 4 , 10 , 19 ]. Two primary mechanisms, specifically the kdr L1014F mutation and cytochrome P450 monooxygenases, have been identified as being responsible for deltamethrin resistance in the Thai Cx. quinquefasciatus population [ 4 ]. The kdr L1014F mutation, in particular, is widespread at a high frequency throughout Thailand [ 19 ]. This study aimed to assess the resistance levels of Cx. quinquefasciatus to deltamethrin conferred by CYP450-mediated resistance, both independently and in combination with the kdr L1014F mutations. We focus on analyzing the expression levels of CYP450 genes and identifying mutations in the vgsc gene that contribute to deltamethrin resistance in Cx. quinquefasciatus populations in Thailand. The findings of this study have direct implications for implementing resistance management strategies against populations carrying these resistance mechanisms, either individually or in combination.

Methods

Mosquito strain and deltamethrin selection

Five strains of Cx. quinquefasciatus, including two field-collected parental strains (Cq_SP and Cq_NiH), two deltamethrin-selected strains (Cq_SP-R and Cq_NiH-R), and a reference susceptible Cq_Sus strain, were used in this study. All five mosquito strains have been maintained and reared at 25 ± 2 ℃ under a photoperiod of 12:12 (L: D) h in the insectary of the Department of Parasitology, Faculty of Medicine, Chiang Mai University (CMU), Thailand.

Larvae and pupae of Cx. quinquefasciatus were collected from the Sri Phum Sub-District, Muang District, Chiang Mai Province, Thailand (18°47′35″ N, 98°58′54″ E) in 2019 [ 10 ]and were subsequently maintained as a colony designated as the Cq_SP strain. The Cq_NiH strain was obtained from the National Institute of Health, Department of Medical Sciences, Ministry of Public Health, Thailand and has been maintained continuously in the CMU insectary since 2015. This strain was a long-established colony originally collected from Pom Prab Satru Phai District, Bangkok, Thailand in 1978 [ 20 ]. The susceptible Cq_Sus strain continuously had over 98% mortality in the adult bioassay tested with 0.05% deltamethrin-impregnated WHO paper for over ten generations.

Establishing a deltamethrin-resistant Cq_SP-R strain, the parental Cq_SP strain was subjected to selection pressure with deltamethrin throughout four generations in a controlled laboratory environment. The larvae were exposed to deltamethrin concentrations of 0.18 µg/L, 0.50 µg/L, 1.17 µg/L, and 1.20 µg/L for the first through fourth generations, respectively. These concentrations were determined to effectively induce mortality in 50% of the treated individuals within 24 h. Similarly, the parental Cq_NiH strain was subjected to deltamethrin selection for five generations, leading to the establishment of the deltamethrin-resistant Cq_NiH-R strain. Adults were exposed to 0.05% deltamethrin-impregnated WHO paper in the first two generations. Larvae from the third to fifth generations were then exposed to deltamethrin concentrations of 0.18 µg/L, 0.50 µg/L, and 1.17 µg/L, respectively. Survivors from each generation were retained to continue the selection process.

Insecticide susceptibility test

The larval susceptibility test was performed following the WHO standard guidelines [ 21 ]with slight modifications as previously described [ 4 ]. Briefly, the bioassays were carried out using batches of 25 early 4th instar larvae per beaker containing 250 ml of distilled water. Seven to eight different insecticide concentrations (0.05-5 µg/L) giving 0-100% mortality were tested against the larvae. The bioassays were conducted with four replicates for each concentration using a single beaker for each replication. The stock and serial dilutions of deltamethrin (Supelco, Bellefonte, PA, USA) were prepared in ethanol. In the control experiments, 0.4% ethanol was included in 250 ml of water. Larval mortality was recorded after 24 h exposure. Adult susceptibility tests were conducted following WHO standard methods [ 22 , 23 ]. Due to the high levels of pyrethroid resistance observed in Cx. quinquefasciatus in Thailand [ 4 , 10 , 19 ], Anopheles mosquito discriminating concentrations were used instead of Culex mosquito discriminating concentrations. Four batches of 25, one-two days old, non-blood-fed females were exposed to 0.05% deltamethrin-impregnated paper and 0.75% permethrin-impregnated paper for 60 min in the standard WHO bioassay test tubes. The mortality was scored and recorded after 24 h. Dead (susceptible) and survivor (resistant) mosquitoes after the bioassays were stored at - 20 ℃ until tested.

Gene expression analysis of the Culex quinquefasciatus- cytochrome P450 genes using quantitative real-time PCR (qRT-PCR)

The expression levels of the candidate cytochrome P450 genes, CYP4C52v1, CYP4H34, CYP6AA7, CYP6P14, CYP9AL1, CYP9J34, CYP9J45, and CYP9M10, were measured using quantitative real-time PCR (qRT-PCR). Those candidate genes were selected for expression analysis based on previous evidence indicating their involvement in metabolic resistance [ 13 , 14 , 15 ]. The total RNA was isolated from the fourth instar larvae and one-day-old females of each mosquito strain. The pool of ten mosquitoes was used to extract total RNA for three replications using the illustra ^™ RNAspin Mini Isolation Kit (GE Healthcare, Buckinghamshire, UK), following the manufacturer’s instruction. The total RNA was reversed transcribed to single-strand cDNA using the SuperScript ^™ III First-Strand Synthesis system (Invitrogen, Carlsbad, CA, USA). The qRT-PCR was performed with the SensiFAST ^™ SYBR ^® Lo-ROX Kit (Bioline, Meridian Bioscience, Germany) in the 7500 Fast Real-Time PCR machine (Applied Biosystems, USA). Each qRT-PCR reaction was carried out in 25 µl final volume containing 1 × SYBR ^® Green master mix, 1 µl of cDNA, and the cytochrome P450 genes specific primer pairs [ 24 ]at a final concentration of 5 µmol/L. All samples and negative control were performed in triplicate. The qRT-PCR reaction cycle consists of a denaturing step of 50 ℃ for 2 min, then 95 ℃ for 10 min, followed by 40 cycles of 95 ℃ for 15 s and 60 ℃ for 1 min. The specificity of the PCR reactions was assessed by a melting curve analysis using Dissociation Curves software. Relative expression levels for the cytochrome P450 genes were calculated by the 2 ^-∆∆CT method using 7500 software v2.3 (Applied Biosystems, USA). The expression of the target gene was normalized using the 18S ribosome RNA gene as an endogenous control [ 24 ].

Amplification and DNA sequencing of the fragments of the Culex quinquefasciatus-vgsc gene

The total RNA was isolated from a single and pooled ten mosquitoes of the one-day-old females of each strain for three replications. The single-strand cDNA was synthesized and used as a template for PCR amplification. Four fragments of the Cx. quinquefasciatus-vgsc gene were amplified for encompassing four domains of VGSC protein ( Fig. 1 ) using four pairs of primer, newly designed in this study ( Table 1 ). All PCR reactions were carried out in a volume of 20 µl that contained a final concentration of 1.25 units of Platinum Taq DNA Polymerase High Fidelity (Invitrogen, Carlsbad, CA, USA), 1 × High Fidelity PCR buffer, 0.5 mol/L dNTPs, 2.5 mol/L MgSO ₄ and 0.5 µmol/L each of the forward and reverse primers. The amplifications consisted of an initial heat activation step at 94 ℃ for 90 s, followed by 35 cycles of 94 ℃ for 45 s, 62 ℃ for 45 s, and 68 ℃ for 60 s with a final extension step at 68 ℃ for 10 min. PCR products were analyzed by electrophoresis on 2% agarose gel (Invitrogen, Carlsbad, CA, USA) using a voltage of 120 v for 25 min and visualized under UV light by RedSafe ^™ Nucleic Acid Staining (iNtRON biotechnology, Korea). The PCR products were purified using illustra ^™ ExoStar ^™ 1-Step kit (GE Healthcare, Buckinghamshire, UK). The PCR product was purified and then sent to Macrogen (Seoul, Korea) for DNA sequencing in both directions.

Fig. 1 Schematic of the voltage-gated sodium channel. The VGSC pore-forming α-subunit consists of four homologous repeat domains (I-IV), each with six transmembrane segments (S1-S6) connected by intracellular and extracellular loops. The four fragments of the vgsc gene, including the IS2-IS6 region of domain I (green fragment; F1), the IIS1-IIS6 region of domain II (dark green fragment; F2), the IIIS1-IIIS6 region of domain III (tan fragment; F3) and the IVS1-IVS6 region of domain IV (dark tan fragment; F4) were amplified in this study. Three non-synonymous mutations in the vgsc gene were identified in the resistant strains of Cx. quinquefasciatus. These vgsc mutations, including V240M, novel L925F and kdr L1014F, were indicated by the red and orange circles. The red circle denotes the kdr L1014F mutation observed in both the Cq_SP and Cq_SP-R strains. The orange circle represents two vgsc mutations, V240M and L925F, exclusively found in the Cq_SP-R strain

Primer name	Primer sequence (5′-3′) ^a	PCR product size (bp)	Domain region in VGSC protein
Cq_IS2-IS6_F	AGTGATGGCGCGAGGTTTCA	790	IS2-IS6
Cq_IS2-IS6_R	TTTCGCTGCGGCCGCTTCTT
Cq_IIS1-IIS6_F	ACGAGGACGGTCCGACGTTCAA	970	IIS1-IIS6
Cq_IIS1-IIS6_R	TGCACGGACGCAATCTGGCT
Cq_IIIS1-IIIS6_F	AGAAAAGCGCGACGCCAGCA	956	IIIS1-IIIS6
Cq_IIIS1-IIIS6_R	TGTTGGTTTCGCGGATGGGC
Cq_IVS1-IVS6_F	AAGAAGGCTGGGGGATCGCT	974	IVS1-IVS6
Cq_IVS1-IVS6_R	TCCGGATCGAACTGCTGCCA

Table 1Sequences of primers for amplifying the Culex quinquefasciatus voltage-gated sodium channel gene

^a Primers for amplifying the Cx. quinquefasciatus- vgsc gene fragments were designed using sequences from the Johannesburg strain of Cx. quinquefasciatus, VectorBase Transcript ID CPIJ007595 [ 25 ]. Four pairs of specific primers were designed to encompass the VGSC protein region (domain I-IV) with putative non-synonymous mutations of the Cx. quinquefasciatus-vgsc gene [ 26 ] and used to amplify the DNA fragments.

Genotyping of the CYP9M10 gene and the kdr L1014F mutation in vgsc gene

After exposure to 0.05% deltamethrin WHO paper, the survivor and dead mosquitoes were randomly selected for genotyping. Genomic DNA was extracted from a single mosquito using the method previously described [ 27 ]. Genotyping of the CYP9M10 gene was performed using PCR I and II, previously described [ 28 ], with some modifications. In brief, the PCR reaction was carried out in a 25 μl PCR master mix that contained 1.5 mol/L MgCl ₂, 1 × PCR buffer, 0.2 µmol/L of each primer, 200 µmol/L dNTP, 0.2 U/µl Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA). Each PCR reaction was performed in a 25 μl reaction volume. The PCR master mix contains 1 × PCR buffer, 1.5 mol/L MgCl ₂, 200 µmol/L dNTP, 0.2 U/μl of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA), 0.2 µmol/L each primer of Gen1F and Gen1R for genotyping PCR I, and Gen2Fa and Gen2Fb for genotyping PCR II, and 0.4 µmol/L of Gen2R for genotyping PCR II. The PCR reaction began with a 2-min denaturation step at 94 ℃, followed by 35 cycles of 30 s at 50 ℃, 30 s at 72 ℃, and 30 s at 72 ℃, with a 2-min extension step at 72 ℃. PCR products were analyzed by electrophoresis on 2% agarose gel (Invitrogen, Carlsbad, CA, USA) using a voltage of 100 v for 30 min and visualized under UV light by RedSafe ^™ Nucleic Acid Staining (iNtRON biotechnology, Korea). The kdr L1014F mutations in the Cx. quinquefasciatus-vgsc gene was detected using the tetra-primer AS-PCR and real-time PCR with melt curve analysis methods as described previously [ 19 , 29 ].

Data analysis

The concentration-mortality responses for the larvae susceptibility test were determined by probit analysis [ 30 ]using the LdP Line software (www.Ehabsoft.com/LDPline). The statistical significance of the gene expressions was calculated using a Student’s t-test for all 2-sample comparisons and one-way analysis of variance (ANOVA) for multiple sample comparisons using SPSS version 17.0 (SPSS Inc., Chicago, USA); a value of P ≤ 0.05 was considered statistically significant. Significant overexpression was determined using a cut-off value of a ≥ twofold change in expression [ 31 ]. Nucleotide sequences of the vgsc gene were aligned using Geneious Prime software version 2023.1.2 (Biomatters, Auckland, New Zealand). The genotypes and allele frequencies of the CYP9M10 gene and the kdr L1014F mutation in the vgsc gene of Cx. quinquefasciatus mosquitoes were calculated, and statistical differences between the survivor and dead mosquito groups were examined by Fisher’s exaction test using Genepop [ 32 ].

Results

Toxicity of pyrethroid to the parental and selected resistant strains of Culex quinquefasciatus

The larvae bioassay test of deltamethrin in the parental Cq_SP and Cq_NiH strains showed the levels of lethal concentration 50 (LC ₅₀) of 0.440 µg/L and 0.080 µg/L, respectively. The adult bioassay test of the parental Cq_SP and Cq_NiH strains indicated mortalities of 26.5 and 55.0%, respectively, after exposure to 0.05% deltamethrin-impregnated papers ( Table 2 ). Following four generations of selection on the parental Cq_SP strain using deltamethrin in larval bioassays, the Cq_SP-R strain exhibited an increased LC ₅₀ level of 2.530 µg/L, corresponding to a resistance ratio of 316.2 compared to the Cq_Sus strain. The mortality rate in the adult bioassay of the Cq_SP-R strain was reduced to 0.0% after exposure to 0.05% deltamethrin-impregnated papers ( Table 2 ). After five generations of selection on the parental Cq_NiH strain, the deltamethrin larval bioassay of the Cq_NiH-R strain revealed the LC ₅₀ of 0.480 µg/L and the resistance ratio of 60. The mortality rate in the adult bioassay of the Cq_NiH-R strain dramatically decreased to 16.1% after exposure to 0.05% deltamethrin-impregnated papers ( Table 2 ). In addition, the female Cx. quinquefasciatus of each strain was evaluated using 0.75% permethrin-impregnated paper. The mortality rates of the parental strains, Cq_SP (52.9%) and Cq_NiH (71.0%), exhibited a noticeable decline in the resistant strains Cq_SP-R and Cq_NiH-R, showing 18.2 and 44.3%, respectively ( Table 2 ).

Mosquito strains	Larval bioassay ^a				Adult bioassay ^c
Mosquito strains	LC ₅₀ (µg/L) (tested number)	χ ² (df)	Slope (± SE)	RR ^b	Deltamethrin %Mortality (tested number)	Permethrin %Mortality (tested number)
Cq_SP	0.440 ( n = 700)	1.000 (4)	2.21 (± 0.09)	55.0	26.5 ( n = 162)	52.9 ( n = 153)
Cq_SP-R	2.530 ( n = 700)	1.000 (3)	1.77 (± 0.11)	316.2	0.0 ( n = 116)	18.2 ( n = 122)
Cq_NiH	0.080 ( n = 700)	1.000 (3)	2.32 (± 0.09)	10.0	55.0 ( n = 300)	71.0 ( n = 389)
Cq_NiH-R	0.480 ( n = 700)	1.000 (2)	3.10 (± 0.08)	60.0	16.1 ( n = 186)	44.3 ( n = 210)
Cq_Sus	0.008 ( n = 700)	1.000 (3)	1.41 (± 0.14)	1.0	98.6 ( n = 144)	100.0 ( n = 128)

Table 2Toxicity of pyrethroid against the Culex quinquefasciatus strains using larval and adult bioassays

^a Larval mosquitoes were tested with deltamethrin.

Expression levels of cytochrome P450 genes in Culex quinquefasciatus

Eight candidate cytochrome P450 genes, namely CYP4C52v1, CYP4H34, CYP6AA7, CYP6P14, CYP9AL1, CYP9J34, CYP9J45, and CYP9M10, were investigated for the gene expression levels in both larval and adult stages of the Cx. quinquefasciatus mosquitoes using qRT-PCR analysis. The relative gene expression of each cytochrome P450 gene exhibited variability across developmental stages (larvae and adult) and among different strains of Cx. quinquefasciatus mosquitoes, specifically the Cq_SP and Cq_SP-R strains ( Table 3 ), as well as the Cq_NiH and Cq_NiH-R ( Table 4 ). The relative gene expression ratios with a cut-off value of ≥ twofold higher in the deltamethrin-resistant selected mosquitoes (Cq_SP-R and Cq_NiH-R) compare to their parental strains (Cq_SP and Cq_NiH) and the susceptible strain (Cq_Sus) were considered indicative of significant overexpression of cytochrome P450 genes ( Table 3 , Table 4 ). All eight cytochrome P450 genes were found to be overexpressed in the larvae of the Cq_NiH-R strain. In the adult stage, five of eight genes, CYP6AA7, CYP6P14, CYP9AL1, CYP9J45, and CYP9M10, showed overexpression. Interestingly, the CYP6AA7 and CYP6P14 genes were highly overexpressed with an expression ratio of > tenfold in the larval and adult stages of the Cq_NiH-R strain ( Table 4 ). In the Cq_SP-R strain, the CYP4H34 and CYP9J34 genes were overexpressed in both stages, but three genes, CYP9AL1, CYP9J45, and CYP9M10 revealed an overexpression only in larvae ( Table 3 ).

Stage of mosquito	Transcript ID ^a	Gene	Relative gene expression ± SE ^b		Ratio ^c	P-value ^d
Stage of mosquito	Transcript ID ^a	Gene	Cq_SP (parental strain)	Cq_SP-R (selected strain)	Ratio ^c	P-value ^d
Cytochrome P450 genes involved in up-regulation
Larva	CPIJ011127	CYP4H34* ^#	0.16 ± 0.08	0.93 ± 0.03	5.9	< 0.0001
	CPIJ005959	CYP6AA7*	0.82 ± 0.08	1.78 ± 0.03	2.2	< 0.0001
	CPIJ005955	CYP6P14*	1.78 ± 0.08	3.84 ± 0.02	2.2	< 0.0001
	CPIJ012470	CYP9AL1*	0.44 ± 0.07	1.61 ± 0.06	3.6	< 0.0001
	CPIJ010546	CYP9J34* ^#	0.41 ± 0.09	2.99 ± 0.05	7.3	< 0.0001
	CPIJ010537	CYP9J45*	0.20 ± 0.07	0.62 ± 0.05	3.2	< 0.0001
	CPIJ014218	CYP9M10*	0.10 ± 0.11	0.55 ± 0.08	5.5	< 0.0001
Adult	CPIJ011127	CYP4H34 ^#	0.24 ± 0.05	0.98 ± 0.05	4.0	< 0.0001
	CPIJ010546	CYP9J34 ^#	0.16 ± 0.06	0.77 ± 0.07	4.9	< 0.0001
Cytochrome P450 genes involved in down-regulation
Larva	CPIJ018943	CYP4C52v1	19.18 ± 0.06	14.84 ± 0.07	− 1.3	< 0.0001
Adult	CPIJ018943	CYP4C52v1	0.72 ± 0.13	0.09 ± 0.04	− 8.1	< 0.0001
	CPIJ005959	CYP6AA7	2.79 ± 0.10	0.44 ± 0.05	− 6.4	< 0.0001
	CPIJ005955	CYP6P14	2.36 ± 0.11	0.42 ± 0.04	− 5.6	< 0.0001
	CPIJ012470	CYP9AL1	0.56 ± 0.09	0.19 ± 0.04	− 2.9	< 0.0001
	CPIJ010537	CYP9J45	1.56 ± 0.07	0.06 ± 0.05	− 25.2	< 0.0001
	CPIJ014218	CYP9M10	0.36 ± 0.10	0.14 ± 0.04	− 2.5	< 0.0001

Table 3The relative level of gene expression of cytochrome P450 genes in both larvae and adult stages of the deltamethrin selected Cq_SP-R and its parental Cq_SP strains

^a The transcript ID number from the vectorbase of the Cx. quinquefasciatus genome sequence (http://cquinquefasciatus.vectorbase.org/)

Stage of mosquito	Transcript ID ^a	Gene	Relative gene expression ± SE ^b		Ratio ^c	P-value ^d
Stage of mosquito	Transcript ID ^a	Gene	Cq_NiH (parental strain)	Cq_NiH-R (resistant strain)	Ratio ^c	P-value ^d
Cytochrome P450 genes involved in up-regulation
Larva	CPIJ018943	CYP4C52v1	1.26 ± 0.04	2.49 ± 0.07	2.0	< 0.0001
	CPIJ011127	CYP4H34* ^#	0.39 ± 0.06	1.99 ± 0.05	5.1	< 0.0001
	CPIJ005959	CYP6AA7* ^#	0.41 ± 0.05	9.92 ± 0.06	24.2	< 0.0001
	CPIJ005955	CYP6P14* ^#	0.57 ± 0.05	10.43 ± 0.05	18.2	< 0.0001
	CPIJ012470	CYP9AL1* ^#	0.64 ± 0.06	1.82 ± 0.06	2.8	< 0.0001
	CPIJ010546	CYP9J34*	0.63 ± 0.09	15.11 ± 0.07	24.1	< 0.0001
	CPIJ010537	CYP9J45* ^#	0.74 ± 0.05	3.41 ± 0.07	4.6	< 0.0001
	CPIJ014218	CYP9M10* ^#	0.39 ± 0.05	1.49 ± 0.04	3.8	< 0.0001
Adult	CPIJ018943	CYP4C52v1	0.95 ± 0.08	1.51 ± 0.09	1.6	< 0.0001
	CPIJ005959	CYP6AA7 ^#	0.28 ± 0.06	3.60 ± 0.06	13.0	< 0.0001
	CPIJ005955	CYP6P14 ^#	0.72 ± 0.08	12.94 ± 0.08	18.0	< 0.0001
	CPIJ012470	CYP9AL1 ^#	0.91 ± 0.08	2.42 ± 0.09	2.7	< 0.0001
	CPIJ010537	CYP9J45 ^#	0.31 ± 0.06	2.26 ± 0.07	7.3	< 0.0001
	CPIJ014218	CYP9M10 ^#	1.10 ± 0.06	4.11 ± 0.08	3.7	< 0.0001
Cytochrome P450 genes involved in down-regulation
Adult	CPIJ011127	CYP4H34	4.08 ± 0.07	2.68 ± 0.08	− 1.5	< 0.0001
	CPIJ010546	CYP9J34	4.95 ± 0.06	2.80 ± 0.06	− 1.8	< 0.0001

Table 4The relative level of gene expression of cytochrome P450 genes in both larvae and adult stages of the deltamethrin selected Cq_NiH-R and its parental Cq_NiH strains

^a The transcript ID number from the vectorbase of the Cx. quinquefasciatus genome sequence (http://cquinquefasciatus.vectorbase.org/)

In the larvae stage, CYP6AA7 and CYP9J34 genes exhibited a significant overexpression with the highest expression ratios of > 24-fold, followed by the CYP6P14 gene (18.2-fold) in the Cq-NiH-R strain. The CYP9J34 gene was also overexpressed with a high expression ratio of > sevenfold in the larvae of the Cq_SP-R strain. In the adult stage, the CYP6P14 genes exhibited overexpression (18.0-fold), followed by CYP6AA7 (13.0-fold) and CYP9J45 (7.3-fold) in the Cq_NiH-R strain. After exposure to deltamethrin, the larvae of Cx. quinquefasciatus showed an increase in the expression of cytochrome P450 genes. However, none of these genes were found to be down-regulated in the larvae of the Cq_NiH-R strain. On the other hand, six genes ( CYP4C52v1, CYP6AA7, CYP6P14, CYP9AL1, CYP9J45, CYP9M10) were downregulated in adult stage of Cq_SP-R strain.

Partial sequencing of the Culex quinquefasciatus- vgsc gene

To determine the point mutations in the vgsc gene involved in resistance to deltamethrin, four fragments of the Cx. quinquefasciatus- vgsc gene covering four domains (I-IV) were partially sequenced using direct sequencing. Those fragment sequences of each mosquito strain were submitted to the GenBank database (Genbank: PQ720348-52 for the IS2-IS6 region of domain I, PQ678660-64 for the IIS1-IIS6 region of domain II, PQ720353-57 for the IIIS1-IIIS6 region of domain III and PQ720358-62 for the IVS1-IVS6 region of domain IV). The kdr L1014F mutation was observed in the Cq_SP and the deltamethrin-resistant selected strain of Cq_SP-R ( Fig. 1 ). However, the kdr L1014F mutation was not found in other deltamethrin-resistant Cq_NiH-R or its parental Cq_NiH strains. Interestingly, two more non-synonymous mutations, V240M and new L925F, were identified in the Cq_SP-R strain ( Fig. 1 ). Genotyping of the V240M, L925F and kdr L1014F mutations was then conducted for six individuals of the Cq_SP-R strain using direct sequencing ( Table 5 ). All individuals of the Cq_SP-R strain were heterozygous (L/F925) genotype for the L925F mutation and homozygous mutant (F/F1014) genotype for the kdr L1014F mutation ( Table 5 ). For the V240M mutation, homozygous mutant (M/M240) and heterozygous (V/M240) genotypes were observed at the frequency of 33.3 and 66.7% in the Cq_SP-R strain, respectively.

vgsc mutation	No. of tested	Genotype frequency, n (%)			Allele frequency (%)
vgsc mutation	No. of tested	Homozygous wild type	Heterozygous	Homozygous mutant	Wild type	Mutant
V240M	6	0 (0.0)	4 (66.7)	2 (33.3)	33.3	66.7
L925F	6	0 (0.0)	6 (100.0)	0 (0.0)	50.0	50.0
L1014F	6	0 (0.0)	0 (0.0)	6 (100.0)	0.0	100.0

Table 5Genotyping of the V240M, L925F and kdr L1014F mutations of the vgsc gene for six individual samples from the deltamethrin-resistant strain of Cq_SP-R using direct sequencing

Genotyping of kdr L1014F mutation in the Culex quinquefasciatus-vgsc gene

Genotype frequency of the kdr L1014F mutation in the vgsc gene was conducted on both survivor and dead mosquitoes in five strains of Cx. quinquefasciatus after exposure to 0.05% deltamethrin WHO paper. The genotype frequency of the kdr L1014F mutation differed between survivor and dead mosquitoes in the Cq_SP and Cq_SP-R strains ( Table 6 ). The homozygous mutant (F/F1014) had a higher frequency in the survivor (57.7%) than dead (15.0%) mosquitoes in the Cq_SP strain. The F1014 mutant allele frequency in the Cq_SP survivor mosquitoes (65%) was significantly higher than in the Cq_SP dead mosquitoes (20.0%) ( P < 0.0001). In the Cq_SP-R strain, no dead mosquito was found after exposure to 0.05% deltamethrin WHO paper ( Table 6 ). Only survivor mosquitoes were randomly genotyped for the kdr L1014F mutation. A high homozygous mutant (F/F1014) genotype with a frequency of 87.2% was observed in the survivor Cq_SP-R mosquitoes. Interestingly, the F1014 mutant allele showed a significantly higher frequency in the survivor Cq_SP-R (91%) than Cq_SP (65%) mosquitoes ( P < 0.0001). The Cq_NIH and Cq_NIH-R mosquitoes were examined on survivor and dead specimens, however, only the homozygous wild type (L/L1014) was detected in both strains. Similarly, in the Cq_Sus susceptible strain, only the homozygous wild type (L/L1014) was detected in both survivor and dead mosquitoes.

Strain	Status	No. of tested	kdr L1014F genotyping No. of mosquitoes (% frequency)			Allele frequency (%)		P-value
Strain	Status	No. of tested	L/L	L/F	F/F	L	F	P-value
Cq_SP	Survivor	26	7 (26.9)	4 (15.4)	15 (57.7)	35.0	65.0	< 0.0001*
	Dead	20	15 (75.0)	2 (10.0)	3 (15.0)	80.0	20.0
	Total	46	22 (47.8)	6 (13.1)	18 (39.1)	54.0	46.0
Cq_SP-R	Survivor	39	2 (5.1)	3 (7.7)	34 (87.2)	9.0	91.0	ND
	Dead	0	ND	ND	ND	ND	ND
	Total	39	2 (5.1)	3 (7.7)	34 (87.2)	9.0	91.0
Cq_NiH	Survivor	23	23 (100.0)	0 (0.0)	0 (0.0)	100.0	0.0	1.000
	Dead	24	24 (100.0)	0 (0.0)	0 (0.0)	100.0	0.0
	Total	47	47 (100)	0 (0.0)	0 (0.0)	100.0	0.0
Cq_NiH-R	Survivor	17	17 (100)	0 (0.0)	0 (0.0)	100.0	0.0	1.000
	Dead	17	17 (100)	0 (0.0)	0 (0.0)	100.0	0.0
	Total	34	34 (100)	0 (0.0)	0 (0.0)	100.0	0.0
Cq_Sus	Survivor	2	2 (100.0)	0 (0.0)	0 (0.0)	100.0	0.0	1.000
	Dead	34	34 (100.0)	0 (0.0)	0 (0.0)	100.0	0.0
	Total	36	36 (100.0)	0 (0.0)	0 (0.0)	100.0	0.0

Table 6Genotype and allele frequency of the kdr L1014F mutation in each strain of Culex quinquefasciatus within survivor and dead mosquitoes after exposure to 0.05% deltamethrin WHO paper

^*The mutant F allele showed significantly higher frequencies in survivor mosquitoes than those in dead mosquitoes ( P < 0.0001) using Fisher’s exaction test. L and F are concatenated bases representing leucine and phenylalanine, respectively

Haplotype of CYP9M10 gene in Culex quinquefasciatus

The CYP9M10 gene exhibited overexpression in deltamethrin-resistant selected mosquitoes, encompassing both larvae and adults of Cq_NiH-R and larvae of Cq_SP-R, in comparison to their parents (Cq_NiH and Cq_SP) and susceptible (Cq_Sus) mosquitoes ( Table 3 , Table 4 ). The haplotype of the CYP9M10 gene was assessed in both survivor and dead mosquitoes within each strain of Cx. quinquefasciatus after exposure to 0.05% deltamethrin WHO paper. Only two haplotypes of the CYP9M10 gene, the CuRE1 ( Culex repetitive element 1) inserted and duplicated [D-Cu(+)], and the CuRE1 non-inserted wild type [Cu(-)], were identified across five mosquito strains ( Table 7 ). The homozygous genotype for the CuRE1 non-inserted wild type [Cu(-)/Cu(-)]was prevalent in each strain. The heterozygous genotype for the CuRE1 inserted and duplicated, and the CuRE1 non-inserted wild type [D-Cu(+)/Cu(-)]was detected with a total frequency of 13.3% and 8.3% in Cq_NiH ( n = 30) and Cq_NiH-R ( n= 36), respectively. Both the survivor and dead mosquitoes of the Cq_NiH strain demonstrated a similar frequency of the heterozygous genotype for the D-Cu(+)/Cu(-), but only the survivor mosquitoes of the Cq_NiH-R strain exhibited this heterozygous genotype. No heterozygous genotype for the D-Cu(+)/Cu(-) was observed in the dead group of the Cq_NiH-R strain. However, the Cq_SP, Cq_SP-R and Cq_Sus strains were exclusively homozygous for the Cu(-)/Cu(-) in both the survivor and dead groups.

Strain	Status	No. of tested	CYP9M10 genotyping No. of mosquitoes (% frequency)
Strain	Status	No. of tested	Cu(−)/Cu(−)	D-Cu(+)/Cu(−)
Cq_SP	Survivor	17	17 (100.0)	0 (0.0)
	Dead	18	18 (100.0)	0 (0.0)
	Total	35	35 (100.0)	0 (0.0)
Cq_SP-R	Survivor	24	24 (100.0)	0 (0.0)
	Dead	0	ND	ND
	Total	24	24 (100.0)	0 (0.0)
Cq_NIH	Survivor	24	21 (87.5)	3 (12.5)
	Dead	6	5 (83.4)	1 (16.6)
	Total	30	26 (86.7)	4 (13.3)
Cq_NIH-R	Survivor	19	16 (84.2)	3 (15.8)
	Dead	17	17 (100.0)	0 (0.0)
	Total	36	33 (91.7)	3 (8.3)
Cq_Sus	Survivor	2	2 (100.0)	0 (0.0)
	Dead	22	22 (100.0)	0 (0.0)
	Total	24	24 (100.0)	0 (0.0)

Table 7Genotype frequency of the CYP9M10 gene in the Culex quinquefasciatus within survivor and dead adult mosquitoes after exposure to 0.05% deltamethrin WHO paper

Cu(-), CuRE1 non-inserted (wild type); D-Cu(+), CuRE1-inserted and duplicated (strong type).

Discussion

This study has demonstrated, for the first time, the overexpression of CYP450 genes conferring pyrethroid resistance in the populations of Cx. quinquefasciatus collected from Thailand specifically within the Chiang Mai and Bangkok Provinces. These locations served as the original sites for collecting the Cq_SP and Cq_NiH mosquito strains, respectively. This study explored the mechanisms that contribute to insecticide resistance in populations of Cx. quinquefasciatus in Thailand, which is critically important for public health in the region. With the rise in resistance to pyrethroid, especially deltamethrin, becoming more pronounced [ 4 , 10 , 19 ], it is imperative to comprehend the genetic and biochemical factors contributing to this resistance increase. Understanding these factors is essential for developing effective strategies for vector control [ 5 , 6 , 7 , 8 ].

This study underscored the two primary mechanisms of resistance: metabolic resistance mediated by cytochrome P450 and target site insensitivity associated with kdr mutations. These mechanisms have significant potential to impact the effectiveness of existing insecticide-based interventions [ 5 , 6 , 7 ]. A comprehensive understanding of these mechanisms will enable public health officials to modify and enhance vector control programs effectively. This approach ensures the sustained effectiveness of strategies aimed at reducing mosquito populations. This could play a critical role in reducing the transmission of mosquito-borne diseases, including lymphatic filariasis and other diseases associated with Culex species [ 3 , 5 , 6 , 7 ]. This study ultimately supports the sustainability of public health initiatives in Thailand, contributing to preserving community health and enhancing disease management strategies [ 2 , 6 , 7 ]. These efforts are essential in effectively addressing the challenges posed by evolving resistance.

Several CYP450 genes, CYP4C52v1, CYP4H34, CYP6AA7, CYP6P14, CYP9AL1, CYP9J34, CYP9J45, and CYP9M10, were overexpressed in Cq_NiH-R and Cq_SP-R in larval and adult stages compared to their parent and susceptible strains. The Cq_NiH-R mosquitoes, a deltamethrin-selected strain originally collected from Bangkok Province, exhibited no kdr L1014F mutation. All eight CYP450 genes were significantly overexpressed in the larval stage of the Cq_NiH mosquitoes, while five genes, CYP6AA7, CYP6P14, CYP9AL1, CYP9J45, and CYP9M10, showed overexpression in both larval and adult stages. This suggested that the overexpression of CYP450 genes might be the major mechanism involving deltamethrin resistance throughout the Cq_NiH-R mosquito’s lifespan. However, only two genes, CYP4H34 and CYP9J34, showed significant overexpression in both larval and adult stages of the Cq_SP-R strain. The overexpression of CYP6AA7 and CYP9J34 genes was previously found in both larva and adult permethrin-resistant (PerRes) strains [ 33 ], while the CYP6AA7 were significantly overexpressed in only adult of permethrin-resistant HAmCq ^G8 mosquitoes [ 24 ]. The CYP450 genes may be involved in insecticide pressure in different developmental stages and populations of mosquitoes, with some being specific to particular developmental stages and others protecting the insect’s life cycle [ 34 ].

The overexpression of functional CYP450 genes in resistant insects is a common mechanism of insecticide resistance, and multiple over-transcribed CYP450 genes belonging to the CYP6 and CYP9 families have been identified in pyrethroid resistant Cx. quinquefasciatus mosquito strains or populations [ 13 , 14 , 18 , 33 , 35 , 36 ]. Among these eight overexpressed CYP450 genes, CYP4C52v1, CYP6AA7, CYP6P14, CYP9J34, CYP9J45 and CYP9M10, it has been demonstrated that decreased expression of these CYP450 genes corresponded with the reduced level of insecticide resistance to permethrin via RNA interference (RNAi) analysis [ 14 , 37 ]. Five of those CYP450 genes, CYP6AA7, CYP6P14, CYP9J34, CYP9J45 and CYP9M10, have been functionally confirmed by playing an important role in permethrin degradation pathways using heterogeneous expression and in vitro metabolism study [ 15 , 38 ].

The CYP9M10 gene has also demonstrated a role in conferring permethrin resistance in Cx. quinquefasciatus mosquitoes using the TALENs and CRISPR techniques [ 39 ]. The CYP9M10 gene has been well characterized concerning permethrin resistance only in the larval stage [ 39 , 40 , 41 ]. However, the CYP9M10 gene was overexpressed with a similar expression ratio (~ fourfold) in the larvae and adults of the Cq_NiH-R strain indicating this gene conferred deltamethrin resistance in both mosquito stages. Although the duplicated CYP9M10 haplotype associated with strong larval resistance [ 39 ]was also detected in adults of Cq_NiH-R and its parent, this haplotype likely has little effect on the mortality rate in the adult stage, considering the low allele frequency in both strains.

The higher level of resistance to deltamethrin in the Cq_SP-R than in the Cq_NiH-R might be due to the Cq_SP-R strain carried by the common kdr L1014F. In the Cq_SP-R strain, the kdr L1014F mutation is associated with resistance against deltamethrin, typer II pyrethroid, and is likely confers cross-resistance to permethrin, type I pyrethroid. Insects carrying kdr mutations often exhibit cross-resistance to both type I and type II pyrethroids [ 16 ]. The L1014F mutation is found worldwide in Cx. quinquefasciatus mosquitoes and other insect species have been functionally confirmed to be responsible for kdr in an in vitro expression system, Xenopus oocytes [ 16 ]. In the absence of selection pressure, the frequency of the kdr L1014F allele in houseflies, which was highly resistant, was relatively constant over time. In contrast, there was a fitness cost for the super-kdr (M918T+ L1014F) allele, which significantly decreased over time [ 42 ]. Moreover, we detected two non-synonymous mutations (V240M and L925F) in Cq_SP-R mosquitoes, suggesting they may play a role in deltamethrin resistance.

A small proportion of homozygous wide type L/L1014 (5.1%) and heterozygous L/F1014 (7.7%) mosquitoes of Cq_SP-R were alive after exposure to 0.05% deltamethin WHO paper [ 22 ]due to the additional V240M and L925F mutations in vgsc gene and/or metabolic resistance mechanism. The V240M was previously reported in the pyrethroid-resistant Cx. quinquefasciatus from Myanmar and all mosquitoes were heterozygous (V/M240) genotype analyzed using next-generation sequencing [ 17 ]. The L925F has not been reported in any insect [ 17 , 19 ]. The role of the V240M and novel L925F mutations in resistance requires further investigation. The mutations L932F and I936V in the Brazilian strains of Cx. quinquefasciatus, respectively, have been previously identified to be associated with pyrethroid resistance [ 17 ]. Two other non-synonymous mutations, V978E and D992E, have been identified in deltamethrin-resistant individuals from Chiang Mai Province, Thailand [ 19 ]. The Cq_SP-R strain also exhibited the overexpression of multiple CYP450 genes but at a lower level than the Cq_NiH-R strain. This result indicated that the target site VGSC alteration, particularly kdr L1014F mutation, is not the only mechanism involved in deltamethrin resistance in the Cq_SP-R strain. The overexpression of multiple CYP450 genes may play a role in metabolic resistance in this deltamethrin-selected strain.

The interaction between two pyrethroid resistance loci, kdr and cytochrome P450 monooxygenases, has previously been documented in the pyrethroid-resistant C x. quinquefasciatus strains of Cq_CM-R and JPAL originating from Thailand and Saudi Arabia, respectively [ 4 , 43 , 44 ]. While previous studies utilized the inhibitor, piperonyl butoxide (PBO), to demonstrate the involvement of CYPs in pyrethroid-resistant mosquitoes, PBO does not allow for accurately quantifying the contribution of CYPs to the observed resistance. This study provides additional evidence supporting the contribution of the overexpression of multiple CYP450 genes in insecticide resistance. It provides new light on the interactions between the CYP4H34 and CYP9J34 genes and the kdr L1014F mutation in conferring resistance to deltamethrin.

In addition, it would be valuable to investigate the other CYP450 genes associated with metabolic resistance mediated by cytochrome P450s in the deltamethrin-resistant strain of Cx. quinquefasciatus. A comprehensive analysis of kdr mutations in these mosquitoes, covering the entire length of the Cx. quinquefasciatus-vgsc gene, could provide important insights.

Conclusions

This study highlights the overexpression of multiple CYP450 genes, with or without the kdr L1014F mutation, resulting in a high level of resistance to deltamethrin in Thai populations of Cx. quinquefasciatus. The overexpression of multiple CYP450 genes alone contributes less to resistance. The effect of the combined mechanisms, CYP450- and kdr-mediated resistance, was significantly higher resistance for deltamethrin in Thai populations of Cx. quinquefasciatus. According to our findings, it is recommended to avoid the use of deltamethrin in regions where Cx. quinquefasciatus populations demonstrate a high frequency of kdr L1014F mutation, alongside the observed overexpression of CYP450 genes.

Abstract
Background
Methods
Results
Discussion
Conclusions
References

参考文献

Lupenza E , Gasarasi DB , Minzi OM . Lymphatic filariasis, infection status in Culex quinquefasciatus and Anopheles species after six rounds of mass drug administration in Masasi District, Tanzania . Infect Dis Poverty. 2021;10:20.